Primer designing- designing a Primer by NCBI Tool

Bioinformatics is the subject of today's science. Various Bioinformatics tools are available online. Scholars like to search mainly  NCBI blastp, NCBI blastn, NCBI ftp site, NCBI nucleotide blast, primer blast NCBI, blast 2, blast search, and various other keywords related to Bioinformatics tools.

In this post, you will learn:

• Primer designing for sequencing.
• How to calculate melting temperature 
• How to calculate GC Content 

Let us discuss them one by one.

Primer Designing 

1-Write “Primer designing” in google box.

2-Click on "Primer designing tool - NCBI" as shown below.

3-Select the sequence (in FASTA Format) and copy by pressing Ctrl+C.

(You don't know how to get sequence in FASTA Format? Check it.

4-Page will open which contain 4 sections.

5-Under the heading of PCR Template, Paste the sequence by pressing Ctrl+V

• ·         We can design Primer of suitable length by writing the nucleotide number from which we want to start in the box  after Forward primer From. and where we want to stop primer writing the nucleotide number in the box  after Forward primer To.Similarly we can select suitable nuclotides in Reverse primer.
• ·         Under the heading of Primer Parameter different information is givenPCR product size which is Minimum of 70 and Maximum of 1000 nucleotide. # of primers to return which are 10 Primer melting temperatures (T_m)Min should be 57  Opt should be 60  Max should be 63  Max T_m differencethat should be 3.
• ·         Under heading of Exon/intron selection There will be Intron length range:Min it should be 1000  Max it shoul be 1000000.

6- Now, click on “Get Primer” and wait.

7- Primer of variable length will appear like as shown below,

8- Primer of different length along with Tm, GC content, starting and end point of primer will appear, and primer of any length can be choosen.

How do calculate Melting Temperature

Tm stands for melting temperature and it is calculated by following formula,

Tm= [4 x ( G + C ) + 2 x ( A + T ) ]

For example, in following sequence, GTACATGGCATTGCGGCCTG, Tm is as follows,

Tm= [4x ( 7 + 5 ) + 2 x ( 3 + 5 ) ]

Tm = 4 (12) + 2 (8)

Tm= 48 + 16

Tm= 64 ^oC

How do calculate GC Content 

GC contents is calculate as

GC contents = Number of G and C/ Total number of bases x 100

For example in sequence, GC contents will be,

GC= 12 / 20 x 100 = 60 %

(NOTE: GC content more than 50% is batter)