on December 19, 2019 0

Bioinformatics is the subject of today's science. Various Bioinformatics tools are available online. Scholars like to search mainly  NCBI blastp, NCBI blastn, NCBI ftp site, NCBI nucleotide blast, primer blast NCBI, blast 2, blast search, and various other keywords related to Bioinformatics tools.

In this post, you will learn:
  • Primer designing for sequencing.
  • How to calculate melting temperature 
  • How to calculate GC Content 
Let us discuss them one by one.

Primer Designing 

1-Write “Primer designing” in google box.
2-Click on "Primer designing tool - NCBI" as shown below.


3-Select the sequence (in FASTA Format) and copy by pressing Ctrl+C.
(You don't know how to get sequence in FASTA Format? Check it.

4-Page will open which contain 4 sections.
5-Under the heading of PCR Template, Paste the sequence by pressing Ctrl+V


  • ·         We can design Primer of suitable length by writing the nucleotide number from which we want to start in the box  after Forward primer From. and where we want to stop primer writing the nucleotide number in the box  after Forward primer To.Similarly we can select suitable nuclotides in Reverse primer.
  • ·         Under the heading of Primer Parameter different information is givenPCR product size which is Minimum of 70 and Maximum of 1000 nucleotide. # of primers to return which are 10 Primer melting temperatures (Tm)Min should be 57  Opt should be 60  Max should be 63  Max Tm differencethat should be 3.
  • ·         Under heading of Exon/intron selection There will be Intron length range:Min it should be 1000  Max it shoul be 1000000.
6- Now, click on “Get Primer” and wait.

7- Primer of variable length will appear like as shown below,
8- Primer of different length along with Tm, GC content, starting and end point of primer will appear, and primer of any length can be choosen.



How do calculate Melting Temperature


Tm stands for melting temperature and it is calculated by following formula,
Tm= [4 x ( G + C ) + 2 x ( A + T ) ]

For example, in following sequence, GTACATGGCATTGCGGCCTG, Tm is as follows,
Tm= [4x ( 7 + 5 ) + 2 x ( 3 + 5 ) ]
Tm = 4 (12) + 2 (8)
Tm= 48 + 16
Tm= 64 oC

How do calculate GC Content 

GC contents is calculate as
GC contents = Number of G and C/ Total number of bases x 100

For example in sequence, GC contents will be,
GC= 12 / 20 x 100 = 60 %

(NOTE: GC content more than 50% is batter)

Read more »

on December 15, 2019 0


1-Search for "Mega 7 Bioinformatics" in google box.
2- Go to the link shown below.  


3-On home page select bit 32/bit 64 and click on DOWNLOAD. 


4- Scroll down and click on "Accept."




5- Scroll down and click "download" again after filling the required information.




 6-MEGA 7 will be downloaded.
7- Use it for phylogenetic analysis and other such purposes.



Read more »

on December 12, 2019 0


There are three stages of alignment:
1) Scoring matrix
2) Trace back
3) Alignment

1) Scoring matrix:

There are some rules to perform this step:
1) Gap must be placed in the first box.
2) Direction is from zero to high diagonally.
3) Score of each box comes from three places:
  • Bottom box (+Gap)  
  • Beside box (+Gap) 
  • Diagonal box (match/mismatch)

4) Value of arrow added from significant box.

2)Trace back:

In this step we perform following things:
1) First of all find highest value and mark it.
2) Trace highest value back toward zero.

3)Allignment

Traceback arrow direction.

 Let us discuss each step one by one.
1) Scoring matrix:

Choose two sequences , like,       
A T C G

     --- T C G

Score them like, Match = +1,  Mismatch = -1,  Gap = -2
Draw coordinates, and put these sequence on both coordinates, but put gap at the beginning of each coordinate.



  • Add  “0”  in first box, and started to add value of gap in Column 1 (C-1) and Row 4 (R-4) by the addition of gap value in the incoming value, like add -2 in the box adjacent to 0, then add value of gap in -2, value would be -4, now add gap value in -4, answer would be -6 and so on, fill C-1 and R-4 in same manner.
  • We have to put value in remaining 9 boxes, suppose we have to put value in box shown by arrow, in this box, values can come from three different directions. From the box behind it, from the box bottom it and fro the box which is diagonal, as shown by small arrows.
  • For box behind it, add gap value in -2, answer would be -4, for box bottom it add gap value in -2 answer would be -4, and for the value from diagonal we have to look match mismatch base pair, as, T and A are mismatch so put value of mismatch in this box, which is -1. Now, in this box there are 3 values -4, -4 and -1. From all these 3 value put that value in this box which is largest one. As -1 is largest, value in this box would be -1.


  • From these 3 arrows consider only one arrow from which actual value is com and remove other two arrows. Continue this process in the same way all boxes appeared would be like as shown.



2)Trace back

  • For trace back we have to find out the highest score value, which is +1 in this case.
  • From this value we trace back to 0
  • Note that this +1 has come from 0 that is diagonal to it. Put arrow from +1 to 0
  • Now this zero come from -1 that is diagonal to it as shown by arrow , put arrow in back direction (from 0 to -1)
  • Value of -1 again come from diagonal whose value is -2, put arrow from -1 to -2. We have a straight line of trace backing.



3)Alignment
  • Now note the arrow. If arrows are horizontal or vertical put gap.
  • If arrow is diagonal put  sequence characters.
  • Note +1 comes from value which is at diagonal. And its horizontal and vertical characters are G and G. so put  G
                                                                                                 G
  • For next corresponding box “0” is come from diagonal value. Its sequence character are C and C again a match. So put sequence character.         
                                                 C       G
                                                 C       G
  • Same is for other diagonal value as shown by above table. So sequence would be    
                                             T      C      G
                                             T      C      G
  • For last value there is corresponding sequence” A” vertically and a “Gap” horizontally. So sequence would be,          
                                                                               A     T      C     G
                                                                               ---   T      C     G
So, whole sequence have been obtained again.

Read more »

on December 11, 2019 0

Bioinformatics is the subject of today's science. Various Bioinformatics tools are available online. Scholars like to search mainly  NCBI blastp, NCBI blastn, NCBI ftp site, NCBI nucleotide blast, primer blast NCBI, blast 2, blast search, and various other keywords related to Bioinformatics tools.

In this post, you will learn:
  • How to Convert nucleotide sequence into protein 
  • How to perform BLAST on protein 
   Write NCBI in google box.
   Click on National Center for Biotechnology Information
  From all database choose gene.
   Write name of   gene in the box and click on search.as shown below.


   List of  papers will be open.
  Choose one paper, complete paper will open.
   Scroll down and click on “FASTA.” Sequence will be change in FASTA format.


    Copy this sequence by pressing Ctrl+C.




   In new tab write “sequence format conversion” and open the link shown.
     Choose DNA and paste the sequence in box by pressing Ctrl+V.

     
   Now, scroll down, click on output format, choose “FASTA format” from the box and click on submit.

   Complete sequence, with symbol of “>” will appear.

Copy that sequence by pressing Ctrl+C.                                                                   
In new tab write “SEQUENCE TRANSLATOR TOOL”
Click on the link shown.

     To convert nucleotide sequence into protein, Click on “Launch transeq” under
heading of Nucleotide Sequence Translation as shown:


Paste the sequence in box by pressing Ctrl+V and  Click on SUBMIT.

Nucleotide sequence has been converted into protein

    Now Copy that aminamino acid sequence.
In the new tab re-open, NCBI. Click on National Center for Biotechnology Information.
Click on Resource List (A-Z)



Click on Basic Local Alignment Search Tool (BLAST)



Click on Nucleotide Blast



Paste the sequence and click on Blast.

Graphic Summary, of the protein sequence, will appear.
This compares our query data with standard.



Read more »

on December 09, 2019 0

Bioinformatics is the subject of today's science. Various Bioinformatics tools are available online. Scholars like to search mainly  NCBI blastp, NCBI blastn, NCBI ftp site, NCBI nucleotide blast, primer blast NCBI, blast 2, blast search, and various other keywords related to Bioinformatics tools.
In this post, you will learn:

  • How to download/copy genome sequence 
  • How to change genome format (FASTA Format)
  • How to convert protein into the nucleotide sequence 
  • How to do Blast of the nucleotide sequence 
Let us discuss them one by one.

   Download genome sequence 

   Search NCBI on the google page.
   Click on National Center for Biotechnology Information
   Select gene/protein from “all database" option



   Write the name of the protein/gene on the box and click on "Search" as shown above. All papers related to protein/gene will be open.


                     Play game: Magic Ball 



Click on the protein of the desired organism (complete paper of that organism will appear).


Scroll down and copy this sequence under the heading of “origin” by pressing Ctrl+C.
(don’t copy digits and //)

Change format of genome sequence

Open a new tab and write “sequence format conversion”
Open the link shown below.

Paste the sequence in the box by pressing Ctrl+V.

Click on output format and choose“FASTA format” from the list and click on Submit

 Wait for a while, complete sequence, with the symbol of “>” will appear.



Conversion of the Protein into the Nucleotide 

Copy that sequence by pressing Ctrl+C.                                                                   
In new tab write “SEQUENCE TRANSLATOR TOOL”
Click on the link shown.

                                                                                
To convert protein sequence into nucleotide sequence, click on “Launch Backtranseq”

Paste the sequence in the box by pressing Ctrl+V. Select required species from CODON USAGE TABLE and click submit.

Protein sequence is converted into Gene sequence.


Nucleotide sequence BLAST


 Now Copy that nucleotide sequence.
In the new tab re-open, NCBI. Click on National Center for Biotechnology Information.
Click on Resource List (A-Z)

Click on Basic Local Alignment Search Tool (BLAST)

Click on Nucleotide Blast

Paste the sequence and click on Blast.

Graphic Summary, of the genome sequence, will appear.
This compares our query data with standard.


Read more »
Subscribe to: Posts (Atom)